Went to the end of Sandberg road to a dirt parking lot part of Santiago Hills park.
Found a cracked mud area, with a small amount of water at one end. There were
maybe 2 dozen fish of various sizes gasping in there. I'm going to post
to Craig's list (never have before) telling fish-rescuers about this. Or
fish-eaters.
OTOH we saw what may have been big cat prints in the cracking soft mud,
and the cat may be dining. Still, tragic to see these fish, and no hope
of water (unless it rains this weekend) as the other side of the dam is
dry.
27 November 2009
25 November 2009
tools
Creating some tools at work. Write a text file on a PC, translate to binary,
burn on an eeprom which is connected to a PIC 16F887 which is listening
as a slave on a two-wire RS485 bus.
Also read back and display as a text file.
The text file should be idempotent through the chain, a perfect copy
residing on the remote (and very isolated) eeprom.
Its an SPI eeprom, that's three wires, driven by the 8 bitter.
This so our client can create his own eeproms which control their instruments.
Right now, I have to edit and recompile the firmware; and the development menu lets me program a single integer into the eeprom to ID it. With this, the client will program
everyting about a given instrument which is currently part of the firmware.
Incremental development.
burn on an eeprom which is connected to a PIC 16F887 which is listening
as a slave on a two-wire RS485 bus.
Also read back and display as a text file.
The text file should be idempotent through the chain, a perfect copy
residing on the remote (and very isolated) eeprom.
Its an SPI eeprom, that's three wires, driven by the 8 bitter.
This so our client can create his own eeproms which control their instruments.
Right now, I have to edit and recompile the firmware; and the development menu lets me program a single integer into the eeprom to ID it. With this, the client will program
everyting about a given instrument which is currently part of the firmware.
Incremental development.
piglab
Piglab number three.
Adjusting the Machine. Compiling on a laptop connected to a power generator
which is connected to, being used on, a live (anesthetized) animal.
Since the animal won't survive, we don't need masks, infection from us to him
or her is not a problem. Its like you discovered anesthesia before you figured
out germ theory.
Adjusting the Machine. Compiling on a laptop connected to a power generator
which is connected to, being used on, a live (anesthetized) animal.
Since the animal won't survive, we don't need masks, infection from us to him
or her is not a problem. Its like you discovered anesthesia before you figured
out germ theory.
Got Rubisco?
The Gene for the large RuBisCo subunit is a 1434-mer DNA molecule:
ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGT
GTTAAAGAGTACAAATTGACTTATTATACTCCTGAGTACCAAACCAAG
GATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT
CCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGT
ACATGGACAACTGTATGGACCGATGGACTTACCAGCCTTGATCGTTAC
AAAGGGCGATGCTACCGCATCGAGCGTGTTGTTGGAGAAAAAGATCAA
TATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCT
GTTACCAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTCAAA
GCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTCCTGCTTAT
GTTAAAACTTTCCAAGGTCCGCCTCATGGGATCCAAGTTGAAAGAGAT
AAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCT
AAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCTGTTTATGAATGT
CTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCA
CAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCA
CTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTG
AATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTT
GCTAGAGAATTGGGCGTTCCGATCGTAATGCATGACTACTTAACGGGG
GGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGT
CTACTTCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAG
AAGAATCATGGTATCCACTTCCGGGTATTAGCAAAAGCGTTACGTATG
TCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTTGAA
GGTGAAAGAGACATAACTTTGGGCTTTGTTGATTTACTGCGTGATGAT
TTTGTTGAACAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGG
GTCTCTTTACCAGGTGTTCTACCCGTGGCTTCAGGAGGTATTCACGTT
TGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA
CAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGTAATGCGCCAGGT
GCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTAAAAGCTCGTAAT
GAAGGACGTGATCTTGCTCAGGAAGGTAATGAAATTATTCGCGAGGCT
TGCAAATGGAGCCCGGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAG
ATCGTATTTAATTTTGCAGCAGTGGACGTTTTGGATAAGTAA
http://www.centauri-dreams.org/?p=10283
ATGTCACCACAAACAGAGACTAAAGCAAGTGTTGGATTCAAAGCTGGT
GTTAAAGAGTACAAATTGACTTATTATACTCCTGAGTACCAAACCAAG
GATACTGATATATTGGCAGCATTCCGAGTAACTCCTCAACCTGGAGTT
CCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGT
ACATGGACAACTGTATGGACCGATGGACTTACCAGCCTTGATCGTTAC
AAAGGGCGATGCTACCGCATCGAGCGTGTTGTTGGAGAAAAAGATCAA
TATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCT
GTTACCAACATGTTTACTTCCATTGTAGGTAACGTATTTGGGTTCAAA
GCCCTGCGCGCTCTACGTCTGGAAGATCTGCGAATCCCTCCTGCTTAT
GTTAAAACTTTCCAAGGTCCGCCTCATGGGATCCAAGTTGAAAGAGAT
AAATTGAACAAGTATGGTCGTCCCCTGTTGGGATGTACTATTAAACCT
AAATTGGGGTTATCTGCTAAAAACTACGGTAGAGCTGTTTATGAATGT
CTTCGCGGTGGACTTGATTTTACCAAAGATGATGAGAACGTGAACTCA
CAACCATTTATGCGTTGGAGAGATCGTTTCTTATTTTGTGCCGAAGCA
CTTTATAAAGCACAGGCTGAAACAGGTGAAATCAAAGGGCATTACTTG
AATGCTACTGCAGGTACATGCGAAGAAATGATCAAAAGAGCTGTATTT
GCTAGAGAATTGGGCGTTCCGATCGTAATGCATGACTACTTAACGGGG
GGATTCACCGCAAATACTAGCTTGGCTCATTATTGCCGAGATAATGGT
CTACTTCTTCACATCCACCGTGCAATGCATGCGGTTATTGATAGACAG
AAGAATCATGGTATCCACTTCCGGGTATTAGCAAAAGCGTTACGTATG
TCTGGTGGAGATCATATTCACTCTGGTACCGTAGTAGGTAAACTTGAA
GGTGAAAGAGACATAACTTTGGGCTTTGTTGATTTACTGCGTGATGAT
TTTGTTGAACAAGATCGAAGTCGCGGTATTTATTTCACTCAAGATTGG
GTCTCTTTACCAGGTGTTCTACCCGTGGCTTCAGGAGGTATTCACGTT
TGGCATATGCCTGCTCTGACCGAGATCTTTGGGGATGATTCCGTACTA
CAGTTCGGTGGAGGAACTTTAGGACATCCTTGGGGTAATGCGCCAGGT
GCCGTAGCTAATCGAGTAGCTCTAGAAGCATGTGTAAAAGCTCGTAAT
GAAGGACGTGATCTTGCTCAGGAAGGTAATGAAATTATTCGCGAGGCT
TGCAAATGGAGCCCGGAACTAGCTGCTGCTTGTGAAGTATGGAAAGAG
ATCGTATTTAATTTTGCAGCAGTGGACGTTTTGGATAAGTAA
http://www.centauri-dreams.org/?p=10283
22 November 2009
Work
Well, this blog is supposed to be about work, so here we go.
We submitted a UL build. They immediately found problems, you poke a pin
through a ventilation hole and hit the motherboard. fail. But they will
continue testing.
Then we have more features to be piglab tested. eventually the customer will
run real surgeons with the tool. Plab is tuesday, with new features.
There are response time questions; incomplete safety checks; incomplete
alarms; etc. But they want the ability to modify tool scripts by themselves,
which means making a toolchip programming system --not the crypto (authentication
capable) ics but simple spi eeproms. have to drive them via tool interface boards which have a PIC 16F part and speak RS485. They will get commands from a pc running
a 485 protocol to program the chips.
We submitted a UL build. They immediately found problems, you poke a pin
through a ventilation hole and hit the motherboard. fail. But they will
continue testing.
Then we have more features to be piglab tested. eventually the customer will
run real surgeons with the tool. Plab is tuesday, with new features.
There are response time questions; incomplete safety checks; incomplete
alarms; etc. But they want the ability to modify tool scripts by themselves,
which means making a toolchip programming system --not the crypto (authentication
capable) ics but simple spi eeproms. have to drive them via tool interface boards which have a PIC 16F part and speak RS485. They will get commands from a pc running
a 485 protocol to program the chips.
Drama
Bird in the house today. Wife called animal control, they showed up
but couldn't catch it. 30 foot ceilings.
I eventually got it with a pole and birdnet and sticky tape. When freed,
it didn't fly away. Eventually it died --twisting its neck and extending
its wings like they find fossils of birds and their reptilian ancestors.
Then, limp.
After that we let the cat have it, which was closure for him, and he enjoyed it. Thanksgiving for felines.
....
Yesterday hiking with the kid near the Santiago Oaks park, near the dam, I found a dollar bill on the trail. Day before, I had found one in the cash-return
of the grocery's self-checkout lane. What are the chances of two sequential
finds?
but couldn't catch it. 30 foot ceilings.
I eventually got it with a pole and birdnet and sticky tape. When freed,
it didn't fly away. Eventually it died --twisting its neck and extending
its wings like they find fossils of birds and their reptilian ancestors.
Then, limp.
After that we let the cat have it, which was closure for him, and he enjoyed it. Thanksgiving for felines.
....
Yesterday hiking with the kid near the Santiago Oaks park, near the dam, I found a dollar bill on the trail. Day before, I had found one in the cash-return
of the grocery's self-checkout lane. What are the chances of two sequential
finds?
05 November 2009
Expensive ride
I have in my 8 year old Subaru Forester a quarter million dollar device, one of
only 5 initial production versions of a state of the art electrosurgical
generator.
In the early 90s I drove away from my R&D programmer job at LA (Cedars-Sinai)
with a quarter million dollar video-rate (512 x 512 monochrome :-)
capable disk drive array in the back of my Ford Escort during
the LA Rodney King riots. I saw smoke from work, and dealt with the
exodus traffic. I was taking it to Orange County to get repaired.
The generator currently in my car will be used on a live porcine surgical model tomorrow.
I have the cross-compilation environment on a laptop so I may be compiling code to run
on a medical device being used on a pig, live.
Hifuckinlarious.
Supposedly a pigday costs $10K. That is expensive meat.
Needless to say, the location is confidential. They don't have big
pink "Vivisection" neon signs out front.
My cat just showed up. I spent over an hour this morning with him, purring
at him, etc, since I was up early (daylight savings etc). This gave me comfort
all day.
He's an obligate carnivore, whereas I seem to need carbs with my meat.
Mostly he sustains on kibble, poundcat that he is;
never any human food, by his choice (he's been offered multiply); and fresh
self-harvested rodentia arthropodia and birds, occasionally. He knows to take them to the
downsstairs shower, where they can't get away and are easy to pick up and
hose off for me.
Anyway, tomorrow will be interesting.
only 5 initial production versions of a state of the art electrosurgical
generator.
In the early 90s I drove away from my R&D programmer job at LA (Cedars-Sinai)
with a quarter million dollar video-rate (512 x 512 monochrome :-)
capable disk drive array in the back of my Ford Escort during
the LA Rodney King riots. I saw smoke from work, and dealt with the
exodus traffic. I was taking it to Orange County to get repaired.
The generator currently in my car will be used on a live porcine surgical model tomorrow.
I have the cross-compilation environment on a laptop so I may be compiling code to run
on a medical device being used on a pig, live.
Hifuckinlarious.
Supposedly a pigday costs $10K. That is expensive meat.
Needless to say, the location is confidential. They don't have big
pink "Vivisection" neon signs out front.
My cat just showed up. I spent over an hour this morning with him, purring
at him, etc, since I was up early (daylight savings etc). This gave me comfort
all day.
He's an obligate carnivore, whereas I seem to need carbs with my meat.
Mostly he sustains on kibble, poundcat that he is;
never any human food, by his choice (he's been offered multiply); and fresh
self-harvested rodentia arthropodia and birds, occasionally. He knows to take them to the
downsstairs shower, where they can't get away and are easy to pick up and
hose off for me.
Anyway, tomorrow will be interesting.
Subscribe to:
Posts (Atom)